Journal: Nature genetics

Article Title: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

doi: 10.1038/ng.2359

Figure Lengend Snippet: Expressed genes with significant overall mutation burden in sun-exposed melanoma

Article Snippet: The pBabe-CyPet- RAC1 retroviral expression vector and the pcDNA3- eGFP - RAC1 plasmid were purchased from Addgene.

Techniques: Mutagenesis

Journal: Nature genetics

Article Title: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

doi: 10.1038/ng.2359

Figure Lengend Snippet: Statistical analysis of RAC1 P29S in the Yale tumor cohort

Article Snippet: The pBabe-CyPet- RAC1 retroviral expression vector and the pcDNA3- eGFP - RAC1 plasmid were purchased from Addgene.

Techniques: Mutagenesis

Journal: Nature genetics

Article Title: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

doi: 10.1038/ng.2359

Figure Lengend Snippet: Crystal structure of RAC1 P29S . ( a ) Overall schematic of RAC1 P29S showing the P-loop (pink), switch I (light green), switch II (purple), Mg 2+ (cyan) and the slowly hydrolyzing GTP analog, GMP-PNP (stick format). The red sphere indicates the location of p.Pro29Ser. The dashed box indicates the regions shown in b – e . ( b ) Close-up view showing close contacts of ribose hydroxyls with the switch I region in RAC1 P29S . ( c ) RAC1 WT bound to GMP-PNP. ( d ) HRAS in complex with GMP-PNP (PDB 5P21) . Direct hydrogen bonding between the switch I backbone and ribose are commonly observed in activated HRAS but are less frequently observed in Rho family GTPases, including RAC1. A RAS-like hydrogen bonding pattern is observed in activated RAC1 P29S (dashed red lines). ( e ) Superposition of the switch I region and GMP-PNP. RAC1 P29S is shown in light green, RAC1 WT is shown in gray, and HRAS is shown in light blue. The red sphere indicates the location of p.Pro29Ser. The residues discussed in the text are labeled. The figure was made using CCP4mg .

Article Snippet: The pBabe-CyPet- RAC1 retroviral expression vector and the pcDNA3- eGFP - RAC1 plasmid were purchased from Addgene.

Techniques: Labeling

Journal: Nature genetics

Article Title: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

doi: 10.1038/ng.2359

Figure Lengend Snippet: In vitro RAC1 P29S binding to downstream effectors. ( a ) PAK1 pulldown assay showing that recombinant histidine-tagged RAC1 P29S (His-RAC1 P29S ) has higher binding to its effector PAK1 compared to His-RAC1 WT for samples that include GTP and GTPγS. NC, PAK1-PBD beads alone as a negative control. The His-RAC1 WT and His-RAC P29S lanes show unbound wild-type and mutant protein, as indicated. The multiple bands in all lanes are RAC1; all bands are observed when RAC1 crystals are run on SDS-PAGE. ( b ) RAC1 pulldown assay showing that recombinant His-GST-RAC1 P29S has higher binding to endogenous MLK3 expressed in melanoma cells compared to His-GST-RAC1 WT in all reaction samples. The immobilized recombinant RAC1 proteins were incubated with cell lysates from two independent melanomas (YULAC that is RAC1 WT and BRAF V600K and YUHEF that is RAC1 P29S and BRAF WT ). The figure shows western blot of bound proteins with antibodies to MLK3. As negative controls, we used lysates incubated with GST-bound beads or recombinant RAC1 proteins that were not incubated with cell extracts. The western blot analysis also shows the expression of the relevant proteins in whole-cell lysate (WCL). The reaction mixtures were likely to contain nucleotides contributed by the cell lysates in addition to those added in vitro , as indicated. ( c ) PAK1 pulldown assay comparing the binding activity of RAC1 WT , RAC1 P29S and RAC1 F28L proteins. The numbers under each lane indicate the band density as determined by scanning the membranes with ImageJ.

Article Snippet: The pBabe-CyPet- RAC1 retroviral expression vector and the pcDNA3- eGFP - RAC1 plasmid were purchased from Addgene.

Techniques: In Vitro, Binding Assay, Recombinant, Negative Control, Mutagenesis, SDS Page, Incubation, Western Blot, Expressing, Activity Assay

Journal: Nature genetics

Article Title: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

doi: 10.1038/ng.2359

Figure Lengend Snippet: Cellular function of RAC1 P29S compared to RAC1 WT . ( a ) Western blot analysis of RAC1 in mouse melanocytes infected with wild-type (WT) or mutant RAC P29S retroviral expression vectors compared to nontransfected cells (parental). Actin indicates protein loading in each lane. ( b ) RAC1 P29S enhances melanocyte proliferation. The proliferation of melanocytes transiently expressing RAC1 WT (green) or RAC1 P29S (red) compared to noninfected parental cells (blue). Error bars indicate standard errors. ( c ) RAC1 P29S enhances cell migration. The graphs show the rate of migration of parental, RAC1 WT - and RAC1 P29S -expressing melanocytes at daily intervals. ( d ) RAC1 P29S enhances ERK activation. Western blots of lysates from mouse melanocytes expressing RAC1 WT or RAC1 P29S probed with RAC1, pERK, ERK and actin antibodies, as indicated on the side of the gel. ( e ) Localization of GFP-tagged RAC1 WT (GFP-RAC1 WT ) and GFP-RAC1 P29S in COS-7 cells. COS-7 cells transiently expressing GFP-RAC1 WT (i, ii) or GFP-RAC1 P29S (iii, iv) were fixed with paraformaldehyde and imaged with a spinning-disk confocal-based inverted Olympus microscope. Insets (yellow boxes) illustrate the localization of RAC1 P29S , but not RAC1 WT , in membrane ruffles (compare i and ii to the yellow arrows in iii and iv, respectively). pERK, phosphorylated ERK. Scale bars, 10 μm.

Article Snippet: The pBabe-CyPet- RAC1 retroviral expression vector and the pcDNA3- eGFP - RAC1 plasmid were purchased from Addgene.

Techniques: Cell Function Assay, Western Blot, Infection, Mutagenesis, Expressing, Migration, Activation Assay, Microscopy

Journal: Circulation Research

Article Title: FSP-1 Silencing in Bone Marrow Cells Suppresses Neointima Formation in Vein Graft

doi: 10.1161/circresaha.111.246025

Figure Lengend Snippet: Figure 7. FSP-1 stimulates VSMC prolifer- ation and migration through Rac1- dependent pathway. A and B, After 48 hours of exposure to recombinant FSP-1, VSMC proliferation increased as detected by PCNA expression (A) and BrdU incorporation (B). C, FSP-1 stimulated ERK5 phosphoryla- tion. VSMCs were treated with FSP-1 (100 ng/mL) after serum starvation for 24 hours; cell lysates were collected, and the phosphor- ylation of ERK5, ERK1/2, p38, JNK, and AKT were detected by Western blots. GAPDH was used as a loading control. D, ERK5 siRNA knocked down ERK5 expression in VSMCs. E and F, FSP-1–induced cell proliferation was inhibited by blocking MEK5-ERK5 signaling pathway. VSMCs were transfected with ERK5 siRNA or MEK5 dominant-negative plasmids; the FSP-1–induced proliferative markers were detected by Western blot (E); and the XTT assay were used to measure the cell prolifer- ation (F). The effects of FSP-1 on MEK5/ ERK5 phosphorylation (G) and proliferation (H) were suppressed by dominant-negative Rac1 expression plasmids in VSMCs. I, The expression of dominant-negative MEK5 had no effect on FSP-1–induced Rac1 activation.

Article Snippet: Dominant Rac1 expression plasmid (Rac N17) was obtained from Addgene (Cambridge, MA).15 The MEK5 dominant-negative vector was used as described.16

Techniques: Migration, Recombinant, Expressing, BrdU Incorporation Assay, Western Blot, Control, Blocking Assay, Transfection, Dominant Negative Mutation, XTT Assay, Phospho-proteomics, Activation Assay

Journal: BMC Cancer

Article Title: Rac1 and Cdc42 are regulators of HRas V12 -transformation and angiogenic factors in human fibroblasts

doi: 10.1186/1471-2407-10-13

Figure Lengend Snippet: Evidence that Rac1 activity is essential to maintain HRas V12 -induced tumor formation . Solid lines represent mice that were not administered tetracycline (Tet). Dotted lines represent mice injected with the same cell strain, but mice were given Tet in order to suppress dominant-negative expression. Tumors were measured weekly. When tumors reached a volume of approximately 0.5 cm 3 , mice were sacrificed and the tumors were removed for further analysis. The data are plotted using Kaplan-Meier analyses. (a) PH3MT-tTak-C1 (parent); N = 4 (- Tet), N = 4 (+ Tet) p > 0.1. (b) PH3MT-VC-C2 (vector control); N = 5 (- Tet), N = 6 (+ Tet) p > 0.1. (c) PH3MT-Rac1 N17 -C1; N = 7 (- Tet), N = 9 (+ Tet), p < 0.001. (d) PH3MT-Rac1 N17 -C2; N = 4 (- Tet), N = 6 (+ Tet), p > 0.1. (e & f) Western blots probed with myc (9E10) antibody to detect dominant-negative protein expression in two tumor-derived cell lines (Tumor 1 and Tumor 2) Both blots were probed with β-actin to verify loading.

Article Snippet: To generate MSU-1.1 cell strains expressing GFP-Rac1 V12 or GFP-Cdc42 V12 fusion proteins, the GFP nucleotide sequence from the pCRUZ-GFP vector (Santa Cruz Biotechnology, Santa Cruz, CA) was isolated and ligated into the pcDNA6-V5-HisA vector (Invitrogen, Carlsbad, CA), which confers blasticidin resistance.

Techniques: Activity Assay, Injection, Dominant Negative Mutation, Expressing, Plasmid Preparation, Control, Western Blot, Derivative Assay

Journal: BMC Cancer

Article Title: Rac1 and Cdc42 are regulators of HRas V12 -transformation and angiogenic factors in human fibroblasts

doi: 10.1186/1471-2407-10-13

Figure Lengend Snippet: Evidence that Rac1 and/or Cdc42 activity is essential to maintain HRas V12 -induced tumor formation . Solid lines represent mice that were not administered tetracycline (Tet). Dotted lines represent mice injected with the same cell strain, but mice were given Tet in order to suppress dominant-negative expression. Tumors were measured weekly. When tumors reached a volume of approximately 0.5 cm 3 , mice were sacrificed and the tumors were removed for study. The data are plotted using Kaplan-Meier analyses. (a) PH3MT-Cdc42 N17 -C1; N = 8 (- Tet), N = 8 (+ Tet), p > 0.1. (b) PH3MT-Cdc42 N17 -C2; N = 6 (- Tet), N = 6 (+ Tet), p > 0.1. (c & d) Western blots probed with FLAG antibody to detect dominant-negative protein expression in two tumor derived cell lines (Tumor 1 and Tumor 2). (e) PH3MT-Rac1 N17 /Cdc42 N17 ; N = 9 (- Tet), N = 9 (+ Tet) p < 0.001. (f) Western blots probed with either myc (9E10) or FLAG antibody to detect dominant-negative protein expression in two tumor derived cell lines (Tumor 1 and Tumor 2). All blots were probed with β-actin to verify loading.

Article Snippet: To generate MSU-1.1 cell strains expressing GFP-Rac1 V12 or GFP-Cdc42 V12 fusion proteins, the GFP nucleotide sequence from the pCRUZ-GFP vector (Santa Cruz Biotechnology, Santa Cruz, CA) was isolated and ligated into the pcDNA6-V5-HisA vector (Invitrogen, Carlsbad, CA), which confers blasticidin resistance.

Techniques: Activity Assay, Injection, Dominant Negative Mutation, Expressing, Western Blot, Derivative Assay

Journal: BMC Cancer

Article Title: Rac1 and Cdc42 are regulators of HRas V12 -transformation and angiogenic factors in human fibroblasts

doi: 10.1186/1471-2407-10-13

Figure Lengend Snippet: Transformed phenotypes elicited by expression of Rac1 V12 or Cdc42 V12 in human fibroblasts . (a) MSU-1.1 fibroblasts expressing either GFP alone (MSU-1.1-GFP-VC), or GFP-tagged constitutively-activated proteins. (b) The indicated cell strains were grown in medium with reduced serum (0.5% SCS). Growth curves were plotted. Doubling time was calculated based on an equation derived from a best-fit exponential curve when cells were in log-phase growth. Error bars represent the SD of triplicate experiments. (c) The indicated cell strains were plated in 0.33% agarose and grown for three weeks. Each picture represents one representative field from each cell line. This experiment was completed in triplicate, each with similar results.

Article Snippet: To generate MSU-1.1 cell strains expressing GFP-Rac1 V12 or GFP-Cdc42 V12 fusion proteins, the GFP nucleotide sequence from the pCRUZ-GFP vector (Santa Cruz Biotechnology, Santa Cruz, CA) was isolated and ligated into the pcDNA6-V5-HisA vector (Invitrogen, Carlsbad, CA), which confers blasticidin resistance.

Techniques: Transformation Assay, Expressing, Derivative Assay

Journal: BMC Cancer

Article Title: Rac1 and Cdc42 are regulators of HRas V12 -transformation and angiogenic factors in human fibroblasts

doi: 10.1186/1471-2407-10-13

Figure Lengend Snippet: Activated Rac1 and Cdc42 independently regulate uPA expression . The indicated cell strains were serum starved for 24 hours then stimulated with medium containing 10% SCS. (a) Grown in the absence of tetracycline, PH3MT cell strains expressing a vector control (PH3MT-VC-C2), Rac1 N17 (PH3MT- Rac1 N17 -C1), Cdc42 N17 (PH3MT-Cdc42 N17 -C2) or both Rac1 N17 and Cdc42 N17 (PH3MT-Rac1 N17 /Cdc42 N17 ) were tested for uPA expression levels using ELISA. Data is presented as percent of control. Error bars indicate the SD from triplicate experiments. * indicates significant difference, p < 0.05. ** indicates a significant difference compared to PH3MT-Rac1 N17 -C1 and PH3MT-Cdc42 N17 -C2, p < 0.05. (b) conditioned medium was collected from MSU-1.1 cells expressing GFP alone (MSU-1.1-GFP-VC), GFP-tagged Rac1 V12 (MSU-1.1-GFP-Rac1 V12 ) or GFP-tagged Cdc42 V12 (MSU-1.1-GFP-Cdc42 V12 ), and uPA expression was analyzed. Data is presented as fold-induction of uPA expression. Error bars represent the SD from triplicate experiments. * indicates significant difference, p < 0.05.

Article Snippet: To generate MSU-1.1 cell strains expressing GFP-Rac1 V12 or GFP-Cdc42 V12 fusion proteins, the GFP nucleotide sequence from the pCRUZ-GFP vector (Santa Cruz Biotechnology, Santa Cruz, CA) was isolated and ligated into the pcDNA6-V5-HisA vector (Invitrogen, Carlsbad, CA), which confers blasticidin resistance.

Techniques: Expressing, Plasmid Preparation, Control, Enzyme-linked Immunosorbent Assay

Journal: BMC Cancer

Article Title: Rac1 and Cdc42 are regulators of HRas V12 -transformation and angiogenic factors in human fibroblasts

doi: 10.1186/1471-2407-10-13

Figure Lengend Snippet: Both Rac1 and Cdc42 regulate VEGF expression in non-hypoxic and hypoxic conditions . All cell strains were serum starved for 24 hours prior to exposure to the indicated agent. Conditioned media were collected after 24 hr and ELISA analyses were completed. The data is presented as either percent of control, or fold induction as indicated in the figure. Error bars represent the SD from triplicate experiments. (a) PH3MT cell strains expressing a vector control (PH3MT-VC-C2), Rac1 N17 (PH3MT- Rac1 N17 -C1), Cdc42 N17 (PH3MT-Cdc42 N17 -C2), or both (PH3MT-Rac1 N17 /Cdc42 N17 ), were stimulated with either medium containing 10% SCS, 100 μM DFO, 100 μM CoCl 2 or Hypoxia (1% O 2 ). (b) MSU-1.1 cells expressing GFP alone (MSU-1.1-GFP-VC-C2), or GFP-tagged Rac1 V12 (MSU-1.1-GFP-Rac1 V12 ), or GFP-tagged Cdc42 V12 (MSU-1.1-GFP-Cdc42 V12 ). Cells were stimulated with medium containing 10% SCS. * denotes a significant difference (p < 0.01).

Article Snippet: To generate MSU-1.1 cell strains expressing GFP-Rac1 V12 or GFP-Cdc42 V12 fusion proteins, the GFP nucleotide sequence from the pCRUZ-GFP vector (Santa Cruz Biotechnology, Santa Cruz, CA) was isolated and ligated into the pcDNA6-V5-HisA vector (Invitrogen, Carlsbad, CA), which confers blasticidin resistance.

Techniques: Expressing, Enzyme-linked Immunosorbent Assay, Control, Plasmid Preparation

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Protein Phosphatase 4 Promotes Hepatocyte Lipoapoptosis by Regulating RAC1/MLK3/JNK Pathway

doi: 10.1155/2021/5550498

Figure Lengend Snippet: PP4 regulated JNK activation through a RAC1/MLK3 pathway in hepatocytes. Endoplasmic reticulum (ER) stress and RAC1/MLK3 signaling pathways were measured in palmitate-treated primary hepatocytes and HepG2 cells, PP4 inhibited and PP4 upregulated primary hepatocytes and HepG2 cells. Protein expressions of CHOP and phosphorylation levels of PERK and MLK3 were measured by western blot analysis. RAC1 activation was determined by binding to GST-PAK PBD and subsequent immunoblot analysis in palmitate-treated murine primary hepatocytes (a, c), HepG2 cells (e, g), AD-PP4shRNA and AD-PP4 pretreated murine primary hepatocytes (i, k), and PP4 siRNA-transfected HepG2 cells (m, o). Relative protein levels were quantified by densitometry and normalized (b, d, f, h, j, l, n, p). Data are expressed as means ± SD, and statistical significance for protein levels was determined by Student's t -test or one-way ANOVA ( ∗ p < 0.05).

Article Snippet: RAC1 shRNA lentiviral vectors (sc-36351) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Activation Assay, Protein-Protein interactions, Phospho-proteomics, Western Blot, Binding Assay, Transfection

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Protein Phosphatase 4 Promotes Hepatocyte Lipoapoptosis by Regulating RAC1/MLK3/JNK Pathway

doi: 10.1155/2021/5550498

Figure Lengend Snippet: PP4 regulated JNK activation through a RAC1/MLK3 pathway in vivo. Endoplasmic reticulum (ER) stress and RAC1/MLK3 signaling pathways were measured in western diet-fed mice and mice injected with control AD, AD-PP4shRNA, or AD-PP4 through the tail vein. Protein expressions of CHOP and phosphorylation levels of PERK and MLK3 were measured by western blot analysis. RAC1 activation was determined by binding to GST-PAK PBD and subsequent immunoblot analysis in western diet-fed mice (a, c) and AD-PP4shRNA- (e, g) and AD-PP4-injected (i, k) mice. Relative protein levels were quantified by densitometry and normalized (b, d, f, h, j, l). Data are expressed as means ± SD, and statistical significance for protein levels was determined by Student's t -test ( ∗ p < 0.05, ∗∗ p < 0.01).

Article Snippet: RAC1 shRNA lentiviral vectors (sc-36351) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Activation Assay, In Vivo, Protein-Protein interactions, Western Blot, Injection, Control, Phospho-proteomics, Binding Assay

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Protein Phosphatase 4 Promotes Hepatocyte Lipoapoptosis by Regulating RAC1/MLK3/JNK Pathway

doi: 10.1155/2021/5550498

Figure Lengend Snippet: PP4 regulated lipoapoptosis through regulating the activity of RAC1. HepG2 cells were pretreated with control LV and RAC1 shRNA LV for 24 h followed by palmitate treatment or AD-PP4 transfection. The levels of RAC1, PUMA, Bim, PP4, and c-caspase 3 and phosphorylation levels of JNK and MLK3 were measured by western blot analysis in palmitate treatment cells (a) and AD-PP4-transfected cells (c). Relative protein levels were quantified by densitometry and normalized (b, d). RAC1 activity was determined by binding to GST-PAK PBD and subsequent immunoblot analysis in AD-PP4- (e, f) and PP4 siRNA- (g, h) transfected cells. HepG2 cells were transfected with control AD or AD-PP4 for 24 h. The interaction between PP4 and RAC1 was confirmed using coimmunoprecipitation with an anti-PP4 antibody (i) and RAC1 antibody (j). Data are expressed as means ± SD, and statistical significance for protein levels was determined by Student's t -test or one-way ANOVA ( ∗ p < 0.05, ∗∗ p < 0.01).

Article Snippet: RAC1 shRNA lentiviral vectors (sc-36351) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Activity Assay, Control, shRNA, Transfection, Phospho-proteomics, Western Blot, Binding Assay

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Protein Phosphatase 4 Promotes Hepatocyte Lipoapoptosis by Regulating RAC1/MLK3/JNK Pathway

doi: 10.1155/2021/5550498

Figure Lengend Snippet: Molecular mechanism by which PP4 participates in hepatocyte lipoapoptosis. Stimulation of PP4 by SFAs causes enhanced GTPase activity of RAC1 possibly by dephosphorylating RAC1, which subsequently activate MLK3/JNK pathway, which led to elevated expression of Bcl-2 proapoptotic family members and promoted hepatocyte lipoapoptosis.

Article Snippet: RAC1 shRNA lentiviral vectors (sc-36351) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Activity Assay, Expressing

Journal: Oncogene

Article Title: TIPE1 induces apoptosis by negatively regulating Rac1 activation in hepatocellular carcinoma cells.

doi: 10.1038/onc.2014.208

Figure Lengend Snippet: Figure 5. TIPE1 inhibits Rac1 activation, leading to cell growth repression. (a) Co-immunoprecipitation to test the interaction between TIPE1 and Rac1 in HEK293 cells. (b) Pull-down assay to detect the GTP-Rac1 level in HEK293 cells. (c) Western blot to detect protein levels of p-p65, p65, p-JNK and JNK in HEK293 cells 8 h after transfection with or without pRK5-myc-Rac1-Q61L and increasing amounts of pcTIPE1-HA plasmids. (d) Cytometry analysis of Bel7402 cells after co-transfected with TIPE1 and pRK5-myc-Rac1-Q61L plasmids for 24 h. (e) Rac1 knockdown destroys the increased cell growth induced by TIPE1 siRNA 313 in HepG2.2.15 cells. **Po0.01. TIPE1 and Rac1 levels were determined by reverse transcription–PCR. The experiments were repeated for three times and one representative result is shown.

Article Snippet: Wild-type Rac1 expression plasmid pRK5myc-Rac1-wt, activated Rac1 expression plasmid pRK5-myc-Rac1-Q61L and activated H-Ras expression plasmid pBabe H-Ras 12V were obtained from Addgene (Cambridge, MA, USA).

Techniques: Activation Assay, Immunoprecipitation, Pull Down Assay, Western Blot, Transfection, Cytometry, Knockdown, Reverse Transcription

Journal: Oncogene

Article Title: TIPE1 induces apoptosis by negatively regulating Rac1 activation in hepatocellular carcinoma cells.

doi: 10.1038/onc.2014.208

Figure Lengend Snippet: Figure 5. TIPE1 inhibits Rac1 activation, leading to cell growth repression. (a) Co-immunoprecipitation to test the interaction between TIPE1 and Rac1 in HEK293 cells. (b) Pull-down assay to detect the GTP-Rac1 level in HEK293 cells. (c) Western blot to detect protein levels of p-p65, p65, p-JNK and JNK in HEK293 cells 8 h after transfection with or without pRK5-myc-Rac1-Q61L and increasing amounts of pcTIPE1-HA plasmids. (d) Cytometry analysis of Bel7402 cells after co-transfected with TIPE1 and pRK5-myc-Rac1-Q61L plasmids for 24 h. (e) Rac1 knockdown destroys the increased cell growth induced by TIPE1 siRNA 313 in HepG2.2.15 cells. **Po0.01. TIPE1 and Rac1 levels were determined by reverse transcription–PCR. The experiments were repeated for three times and one representative result is shown.

Article Snippet: Wild-type Rac1 expression plasmid pRK5myc-Rac1-wt, activated Rac1 expression plasmid pRK5-myc-Rac1-Q61L and activated H-Ras expression plasmid pBabe H-Ras 12V were obtained from Addgene (Cambridge, MA, USA).

Techniques: Activation Assay, Immunoprecipitation, Pull Down Assay, Western Blot, Transfection, Cytometry, Knockdown, Reverse Transcription

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Inputs and anti-Flag immunoprecipitates of lysates from HeLa cell ectopically expressing the indicated Flag-tagged OtDUB fragments. Proteins were resolved by SDS-PAGE and immunoblotted for Rho GTPases (Rac1,2,3; Cdc42; RhoA). (b) FLAG (top) and reciprocal GST (bottom) pulldown experiments between purified recombinant FLAG-tagged OtDUB fragments and GST-tagged Rac1 or Cdc42. Proteins were resolved by SDS-PAGE and stained with Coomassie Blue. (c) Time course of the dissociation of BODIPY-GDP from Rac1 or Cdc42 (9 μM) in the presence of OtDUB 275-1369 (0, 50, or 250 nM) as measured by loss of BODIPY-GDP fluorescence. Excitation and emission wavelength were 488 nm and 535 nm, respectively.

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Expressing, SDS Page, Purification, Recombinant, Staining, Fluorescence

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) OtDUB fragments expressed in yeast. Transformants were grown for 4 h in minimal liquid medium containing galactose. After induction, equivalent optical density units (ODU) were processed and extracts from 0.25 ODU were resolved by SDS-PAGE and immunoblotted with anti-Flag antibody, then Ponceau stained (PonS) for loading comparison. Absorbance by dead cells results in reduced Ponceau signal for C135A and 275-1369. (b) Fluorescent nucleotide exchange assays demonstrate absence of activity against RhoA in the OtDUB 275-1369 fragment (left), and absence of activity against Rac1 in truncation construct OtDUB 657-1369 . (c) Input proteins from pulldown experiment in .

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: SDS Page, Staining, Comparison, Activity Assay, Construct

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) OtDUB truncations used for mapping studies (top) and GST pulldown experiment using GST-OtDUB fragments as bait and Rac1 as prey (bottom). Gel was stained with Coomassie Blue. N-terminal truncation to residue 580 abolished binding, whereas the 548-759 fragment (OtDUB GEF domain) retained full binding capacity. (b) Size exclusion chromatography of OtDUB GEF :Rac1 mixtures demonstrates stable complex formation (top). Column fractions were evaluated by SDS-PAGE and protein staining (bottom). (c) Time course of the dissociation of BODIPY-GDP from Rac1 in the presence of increasing amounts of OtDUB GEF (residues 548-759). Raw fluorescence curves were fit to a single exponential decay (top), and initial rates were plotted against Rac1 concentration (bottom). Linear transformation of the titration yielded a k cat /K M of 2.6 ± 0.3 ×10 5 M -1 s -1 .

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Staining, Residue, Binding Assay, Size-exclusion Chromatography, SDS Page, Fluorescence, Concentration Assay, Transformation Assay, Titration

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Size exclusion chromatography (SEC) of OtDUB GEF :Cdc42 mixtures, as in . (b) A 260/280 ratios for fractions in each SEC run. OtDUB GEF alone and GTPase alone runs have A 260/280 of 0.6-0.9, whereas complex peaks formed after mixing are devoid of nucleotide ( A 260/280 ∼ 0.5). Exchanged nucleotide is also observed at late elution volumes (triangle). (c) Isothermal titration calorimetry quantification of binding affinity for OtDUB GEF and Rac1 (K d ∼ 5 μM) or Cdc42 (K d ∼ 16 μM). (d) Fluorescent nucleotide exchange assays as in , except with Cdc42 instead of Rac1, with increasing concentrations of OtDUB GEF . (e) Linear transformation and calculated k cat / K M values for Rac1 (2.6 ± 0.3 ×10 5 M -1 s -1 ) and Cdc42 (1.7 ± 0.1 ×10 4 M -1 s -1 ).

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Size-exclusion Chromatography, Isothermal Titration Calorimetry, Binding Assay, Transformation Assay

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Three orthogonal views of the complex with OtDUB GEF in purple and Rac1 in cyan. Switch I and II loops are in salmon and yellow, respectively, and the β2-3 hairpin selectivity interface is green. (b) Close-up views of each key interface between OtDUB GEF and Rac1 showing selected residues, with hydrogen bonds and electrostatic interactions shown as dashes, water molecules as red spheres. (c) GST pulldown assays (left) of GST-OtDUB GEF (WT or charge-neutralizing mutations at each interface) incubated with Rac1 and analyzed by SDS-PAGE and Coomassie Blue staining. Corresponding BODIPY-GDP release assays are shown on the right. (d) Close-up views of each interface comparing the OtDUB GEF residues interacting with Rac1 (thick sticks) to the interactions made by other bacterial GEFs (thin sticks).

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Incubation, SDS Page, Staining

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Overall crystal structure of OtDUB GEF resolved to 3.0 Å, with six copies in the asymmetric unit (ASU), with the 2Fo-Fc electron density map (mesh) contoured at 1.0 σ. Pairwise Cα RMSDs between copies in the ASU ranges from 0.36 to 1.9 Å. (b) Overall crystal structure of OtDUB GEF in complex with Rac1 resolved to 1.7 Å, with the 2Fo-Fc electron density map (mesh) contoured at 1.0 σ. The asymmetric unit contains two copies each of OtDUB GEF and of Rac1. Each complex is virtually identical, with Cα RMSD between complexes of 0.1 Å. Inset: detailed view of the nucleotide-binding region of Rac1 reveals absence of electron density for GDP (modeled, grey). (c) Size exclusion chromatography of OtDUB GEF/Δlever :Rac1 mixtures. The late eluting peak representing exchanged nucleotide, which was observed with wild-type OtDUB GEF , is absent. (d) Structural comparison of six copies of OtDUB GEF from the apo structure (green shades) and two copies of OtDUB GEF from the Rac1 complex structure (purple shades). Inset: detailed view of the catalytic lever region reveals a rigid conformation in both apo and complex OtDUB GEF molecules.

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Binding Assay, Size-exclusion Chromatography, Comparison

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) β2-3 hairpin “interswitch” regions from Rac1, Cdc42, and RhoA are shown as cartoon and transparent surface, with surface-exposed residues as sticks. (b) Structural alignment of the selectivity patches of Cdc42 and RhoA reveal steric clashes with RhoA that likely prevent binding with OtDUB GEF (purple surface and sticks)

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Binding Assay

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: Structural alignment by GTPase (surface) of available bacGEFs (cylinders): SopE (red), Map (yellow), IpgB2 (green), and OtDUB GEF (purple) highlight convergence on a conserved V-shaped fold on the same location on Rac1.

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques:

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Top: Structural overlay of GTPases from GDP-bound (PDB: 5N6O, grey) and GEF-bound structures: OtDUB GEF (cyan), SopE (red), Map (yellow), and TIAM1 (slate). GEFs are removed for clarity. Switch I residues Glu 62 , Ala 59 , and Lys 16 are shown as sticks. Arrows indicate the previously observed motions of the residues upon GEF binding. Bottom: BODIPY-GDP exchange assay reveals that Glu 62 is not required for efficient exchange catalyzed by OtDUB GEF . (b) Top: A loop of OtDUB GEF that interrupts α2 acts as a “catalytic lever” to promote release of GDP. OtDUB GEF is shown as cartoon (purple), and Rac1 is shown as transparent surface (cyan). GDP (not present in our structure) is modeled based on PDB 5N6O for reference. The steric clash and electrostatic repulsion are indicated by the red lines. Bottom: Nucleotide exchange assay reveals a strict requirement in the lever segment for exchange of BODIPY-GDP. (c) Calculated electrostatic surface potential map (unit k B T/e) shows high negative charge in the OtDUB GEF lever formed by a tri-carbonyl motif at the vicinity of the diphosphate group of GDP.

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Binding Assay

Journal: bioRxiv

Article Title: Crystal structure of a novel guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi

doi: 10.1101/2020.06.04.133876

Figure Lengend Snippet: (a) Lysates from HeLa cells carrying empty vector or plasmids expressing wild-type or E572A OtDUB were subjected to GST-Pak1PBD pulldowns to enrich active Rac1 and Cdc42. Representative experiment (left) from 4 independent experiments that were quantified (right) relative to input levels and the empty vector control. Bars represent mean and S.D. P value determined from a two-tailed unpaired Student t-test. Outlier from Rac1 wild-type (5.4 fold increase in activity) excluded one trial. Outlier was identified using Grubbs algorithm with alpha = 0.05. (b) Representative epifluorescence images of fibroblasts carrying the vector expressing only GFP or plasmids expressing wild-type or E572A OtDUB GEF . (c) Quantification of cell area, perimeter, and major axis length.

Article Snippet: DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites.

Techniques: Plasmid Preparation, Expressing, Control, Two Tailed Test, Activity Assay

Journal: Theranostics

Article Title: Serelaxin alleviates cardiac fibrosis through inhibiting endothelial-to-mesenchymal transition via RXFP1

doi: 10.7150/thno.38640

Figure Lengend Snippet: Primers used in qPCR assay for gene expression analysis

Article Snippet: , Rac1 , F: TCTCCAGGAAATGCATTGGT R: AGATGCAGGCCATCAAGTGT , Origene.

Techniques: Gene Expression, Sequencing